cxcl 3  (Boster Bio)

Journal: Oncology Letters

Article Title: Overexpression of B7-H4 promotes renal cell carcinoma progression by recruiting tumor-associated neutrophils via upregulation of CXCL8

doi: 10.3892/ol.2020.11701

Figure Lengend Snippet: Association of B7-H4 with the differentially expressed genes is confirmed in clinical renal cell carcinoma tissues and TCGA datasets. (A) RNA-sequencing data of TCGA data analysed using the Gene Expression Profiling Interactive Analysis website. The correlation of B7-H4 gene in kidney renal papillary cell carcinoma was analysed using the Pearson's correlation test. (B) Immunohistochemical analysis of B7-H4, CCL20 and CXCL8 in clinical renal cell carcinoma tissues. Representative images are shown. Magnification ×400. Scale bar, 400 µm. (C) Statistical analysis of the CCL20 and CXCL8 levels in B7-H4 high and B7-H4 low tissues using the Student's t-test. **P<0.01. B7-H4, B7 family member, H4; TCGA, The Cancer Genome Atlas; CCL20, C-C motif chemokine ligand 20; CXCL8, C-X-C motif chemokine ligand.

Article Snippet: The primary antibodies used were as follows: NME1 (1:500; cat. no. 11086-2-AP, Proteintech Group, Inc.); membrane metalloendopeptidase (MME; 1:500; cat. no 18008-1-AP; Proteintech Group, Inc.); vanin 1 (VNN1; 1:300; cat. no. 21745-1-AP; Proteintech Group, Inc.); matrix metalloproteinase 7 (MMP7; 1:300; cat. no. 10374-2-AP; Proteintech Group, Inc.); tumor necrosis factor α (TNF-α; 1:2,000; cat. no. 60291-1-Ig; Proteintech Group, Inc.); human C-X-C motif chemokine ligand (CXCL) 1/2/3 (1 μg/ml; cat. no. MAB276; R&D Systems, Inc.); CXCL8 (1:500; cat. no. 27095-1-AP; Proteintech Group, Inc.); human C-C motif chemokine ligand 20 (CCL20; 1 μg/ml); cat. no. MAB360; R&D Systems, Inc.); B7-H4 (1:500; cat. no. 12080-1-AP; Proteintech Group, Inc.); β-actin (1: 5,000; cat. no. 66009-1-Ig; Proteintech Group, Inc.) and α-tubulin (1:2,000; cat. no. 11224-1-AP; Proteintech Group, Inc.) were used.

Techniques: RNA Sequencing, Gene Expression, Immunohistochemical staining

Journal: Oncology Letters

Article Title: Overexpression of B7-H4 promotes renal cell carcinoma progression by recruiting tumor-associated neutrophils via upregulation of CXCL8

doi: 10.3892/ol.2020.11701

Figure Lengend Snippet: Evaluation of the effects of CXCL8 on the B7-H4-mediated promotion of tumor growth and tumor-infiltrating neutrophils. 786-O transfectants were inoculated into non-obese diabetic/severe combined immunodeficiency mice (n=6/group). (A) Tumor growth curve was evaluated by assessing tumor volume. The tumor volumes on day 21 showed significance, ***P<0.001. (B) Tumor weight was evaluated after 21 days of treatment with isotype IgG or anti-CXCL8 antibody (n=6). (C) Fold-change of tumor weight between the isotype IgG and anti-CXCL8 antibody groups. (D) Gating strategy of CD11b + Ly6G + in tumor tissues is shown. (E) Tumor-infiltrating neutrophils were analysed by flow cytometry. Cells from tumor tissues were stained with fluorescein conjugated CD45, CD11b and Ly6G. The ratio of CD11b + Ly6G + in CD45 + cells was evaluated by flow cytometry. (F) Statistical analysis of the ratio CD11b + Ly6G + /CD45 + (n=6). Multiple comparisons among the groups were performed using the Tukey's post hoc test. *P<0.05, **P<0.01, ***P<0.001, as indicated. CXCL8, C-X-C motif chemokine ligand; B7-H4, B7 family member, H4; CD, cluster of differentiation; Ly6G, lymphocyte antigen 6 complex, locus G.

Article Snippet: The primary antibodies used were as follows: NME1 (1:500; cat. no. 11086-2-AP, Proteintech Group, Inc.); membrane metalloendopeptidase (MME; 1:500; cat. no 18008-1-AP; Proteintech Group, Inc.); vanin 1 (VNN1; 1:300; cat. no. 21745-1-AP; Proteintech Group, Inc.); matrix metalloproteinase 7 (MMP7; 1:300; cat. no. 10374-2-AP; Proteintech Group, Inc.); tumor necrosis factor α (TNF-α; 1:2,000; cat. no. 60291-1-Ig; Proteintech Group, Inc.); human C-X-C motif chemokine ligand (CXCL) 1/2/3 (1 μg/ml; cat. no. MAB276; R&D Systems, Inc.); CXCL8 (1:500; cat. no. 27095-1-AP; Proteintech Group, Inc.); human C-C motif chemokine ligand 20 (CCL20; 1 μg/ml); cat. no. MAB360; R&D Systems, Inc.); B7-H4 (1:500; cat. no. 12080-1-AP; Proteintech Group, Inc.); β-actin (1: 5,000; cat. no. 66009-1-Ig; Proteintech Group, Inc.) and α-tubulin (1:2,000; cat. no. 11224-1-AP; Proteintech Group, Inc.) were used.

Techniques: Flow Cytometry, Staining

Journal: Nanomaterials

Article Title: In Vitro and In Vivo Assessment of PEGylated PEI for Anti-IL-8/CxCL-1 siRNA Delivery to the Lungs

doi: 10.3390/nano10071248

Figure Lengend Snippet: CXCL-1 ( A ) gene and ( B ) protein expression in lipopolysaccharide (LPS)-stimulated rat lungs. Animals were intra-tracheally administered 75 µg of non-targeting (NT) siRNA or anti-CXCL-1 siRNA (N/P = 7) 21 h prior to stimulating with 200 µg of LPS. Animals were euthanised 3 h post-LPS stimulation. CXCL-1 expression was normalised to the β-actin control gene expression (Kruskal–Wallis test and Dunn’s post-hoc test, * p < 0.05, min of n = 3 ± SD).

Article Snippet: The siRNA sequences for rat CXCL-1 (5′ UAACGAGAUAUUUAACGCCCCC 3′) were obtained from (Riboxx GmbH, Radebeul, Germany), and the siGENOME non-targeting siRNA #2 (5′ UAAGGCUAUGAAGAGAUAC 3′) scrambled sequence controls were obtained from Dharmacon (now Horizon Discovery, Cambridge, UK).

Techniques: Expressing

Journal: Nanomaterials

Article Title: In Vitro and In Vivo Assessment of PEGylated PEI for Anti-IL-8/CxCL-1 siRNA Delivery to the Lungs

doi: 10.3390/nano10071248

Figure Lengend Snippet: ( A ) Total cell population per mL of bronchoalveolar lavage (BAL) from the hemocytometer quantification ( B ) Macrophage population quantification from BAL image analysis (5 fields/animal) and representative images for each group including ( C ) PBS-PBS, ( D ) PBS-LPS, ( E ) PEI NT siRNA nanoparticle, ( F ) PEI CXCL-1 siRNA nanoparticle, ( G ) PEI-LPEG NT siRNA nanoparticle and ( H ) PEI-LPEG CXCL-1 siRNA nanoparticle-treated rats 24 h post-transfection. Images taken at 100× magnification (Kruskal–Wallis test and Dunn’s post-hoc test, * p < 0.05, *** p < 0.001, min of n = 3 ± SD).

Article Snippet: The siRNA sequences for rat CXCL-1 (5′ UAACGAGAUAUUUAACGCCCCC 3′) were obtained from (Riboxx GmbH, Radebeul, Germany), and the siGENOME non-targeting siRNA #2 (5′ UAAGGCUAUGAAGAGAUAC 3′) scrambled sequence controls were obtained from Dharmacon (now Horizon Discovery, Cambridge, UK).

Techniques: Transfection